Skip to main content

Table 6 The DNA sequence \(\bar {H}^{(0)}\)

From: Secure Hash Algorithm-2 formed on DNA

\(\bar {H}_{1}^{(0)}= CGGGAAGCTGCGCGCTTTATGTTATAGCAAGA\)
\(\bar {H}_{2}^{(0)}= GTGTCGCTGGTGGACCGACATAGGGGCTATGT\)
\(\bar {H}_{3}^{(0)}= ATTACGTGTTATCTAGTTTGGCCATTGAAGGT\)
\(\bar {H}_{4}^{(0)}= GGCCCATTTTCCATGGCCTTACTCATCGTTAC\)
\(\bar {H}_{5}^{(0)}= CCACAATGCCAGCTTTGGTCTGCGGAAGTCAC\)
\(\bar {H}_{6}^{(0)}= GCGTAACCCGGAGATAAGGTATTGCGTAACTT\)
\(\bar {H}_{7}^{(0)}= ACTTGAATTCGCGGGTTTGTCAACGTTCCGGT\)
\(\bar {H}_{8}^{(0)}= CCGTTGAATATCACGCACATCTTGAGACCTGC\)